[원서][생화학1] Biochemis.pdf

1. 자료설명


[원서][생화학1] Biochemistry(8th ed) -Jeremy M. Berg, John L. Tymoczko, Lubert Stryer -W. H. Freeman

2. 목차 및 본문내용


1. Prelude: Biochemistry and the Genomic Revolution

GACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTT CAGAGGGTAAAAATTAAGCACAGTGGAAGAATTTCATTC TGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAG AAAATATCTTTGGTGTTTCCTATGATGAATATAGATACAG AAGCGTCATCAAAGCATGCCAACTAGAAGAG. . .. This string of letters A, C, G, and T is a part of a DNA sequence. Since the biochemical techniques for DNA sequencing were first developed more than three decades ago, the genomes of dozens of organisms have been sequenced, and many more such sequences will be forthcoming. The information contained in these DNA sequences promises to shed light on many fascinating and important questions. What genes in Vibrio cholera, the bacterium that causes cholera, for example, distinguish it from its more benign relatives? How is the development of complex ...
번호 제목 날짜
40154 SK C&C - 기업소개, 연혁, 경쟁사 분석 2019.08.15
40153 1인 창조기업과 경영 - SWOT 전략 2019.08.15
40152 1인 창조기업과 경영 - 용어해설 - e비즈니스 2019.08.15
40151 1인 창조기업과 경영 리포트 2019.08.15
40150 20대들의 신용카드의 사용실태와 합리적인 사용방안 연구 2019.08.15
40149 AGFLATION 2019.08.15
40148 BBQ, 교촌치킨 2019.08.15
40147 DEFENSIVE STRATEGY (방어 전략) 2019.08.15
40146 DMB의 역사, 현황 및 나아갈 방향 2019.08.15
40145 강인욱의 고고학 여행 독후감 2019.08.14
40144 한국은행자소서자기소개서 한국은행 일반기능직원 자소서 한국은행자기소개서 한국은행 일반기능직원 자소서 한국은행자기소개서 한국은행자소서 한국은행자소서 2019.08.14
40143 [원서e북][생화학1] Biochemistry(8th ed) -Jeremy M. Berg, John L. Tymoczko, Lubert Stryer -W. H. Freeman 2019.08.13
40142 [원서][생물정보학입문] Bioinformatics, A practical guide to the analysis of genes and proteins(3 판) - Andrea 2019.08.13
40141 [원서][생물해양학 및 실험 II] Biological oceanography_an introduction(2nd ed) - Carol Lalli, Timothy Parsons - 2019.08.13
40140 [원서][생물해양학특론 II] Microbial Ecology of the Oceans(2판) - David L. Kirchman - Wiley-Blackwell 2019.08.13
» [원서][생화학1] Biochemistry(8th ed) -Jeremy M. Berg, John L. Tymoczko, Lubert Stryer -W. H. Freeman 2019.08.13
40138 [원서][생명과학2] Campbell Biology - concepts & connections(7th ed) - Jane B. Reece, Martha R. Taylor, Eri 2019.08.13
40137 [원서e북][생명과학2] Campbell Biology - concepts & connections(9판) - Martha R. Taylor, Eric J. Simon, Jean 2019.08.13
40136 [원서][분자생물학 2] Molecular Biology of the Cell(6판) - Bruce Alberts, Alexander Johnson, Julian Lewis 2019.08.13
40135 [원서e-book][분자생물학 2] Molecular Biology of the Gene(7판) - James D. Watson et al - Pearson 2019.08.13