[원서][생화학1] Biochemistry(8th ed) -Jeremy M. Berg, John L. Tymoczko, Lubert Stryer -W. H. Freeman
2019.08.13 23:34
1. 자료설명
[원서][생화학1] Biochemistry(8th ed) -Jeremy M. Berg, John L. Tymoczko, Lubert Stryer -W. H. Freeman
2. 목차 및 본문내용
1. Prelude: Biochemistry and the Genomic Revolution
GACTTCACTTCTAATGATGATTATGGGAGAACTGGAGCCTT CAGAGGGTAAAAATTAAGCACAGTGGAAGAATTTCATTC TGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAG AAAATATCTTTGGTGTTTCCTATGATGAATATAGATACAG AAGCGTCATCAAAGCATGCCAACTAGAAGAG. . .. This string of letters A, C, G, and T is a part of a DNA sequence. Since the biochemical techniques for DNA sequencing were first developed more than three decades ago, the genomes of dozens of organisms have been sequenced, and many more such sequences will be forthcoming. The information contained in these DNA sequences promises to shed light on many fascinating and important questions. What genes in Vibrio cholera, the bacterium that causes cholera, for example, distinguish it from its more benign relatives? How is the development of complex ...